Regulon of SusR2 in Bacteroides cellulosilyticus DSM 14838

Properties
Regulator type:	Transcription factor
TF locus tag:	BACCELL_04954
Regulator family:	[Other]
Regulation mode:	repressor
Biological process:	Starch utilization
Effector:
Regulog:	SusR2 - Bacteroidaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Bacteroidaceae
By TF family - [Other]
By pathway - Starch utilization

Regulated operons
	Locus Tag	Name	Function
Position: -208 Score: 5.7 Sequence: ATTTTTACTACTTTTTTGGA Position: -131 Score: 6.2 Sequence: AAAACTACTACTTTTTCACT Locus tag: BACCELL_04952 Name: susC2 Funciton: SusC2, outer membrane protein involved in starch binding Locus tag: BACCELL_04951 Name: susD2 Funciton: SusD2, outer membrane protein involved in starch binding
	BACCELL_04952	susC2	SusC2, outer membrane protein involved in starch binding
	BACCELL_04951	susD2	SusD2, outer membrane protein involved in starch binding

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD