Regulon of UlaR in Citrobacter koseri ATCC BAA-895

Properties
Regulator type:	Transcription factor
TF locus tag:	CKO_03646
Regulator family:	DeoR
Regulation mode:	repressor
Biological process:	Ascorbate utilization
Effector:	Ascorbate-6-phosphate
Regulog:	UlaR - Enterobacteriales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 13 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By TF family - DeoR
By effector - Ascorbate-6-phosphate
By pathway - Ascorbate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -82 Score: 5.3 Sequence: TGATTACTTTTGAAAATTAG Locus tag: CKO_03643 Name: ulaA Funciton: Ascorbate-specific PTS system, EIIC component Locus tag: CKO_03642 Name: ulaB Funciton: Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69) Locus tag: CKO_03641 Name: ulaC Funciton: Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
	CKO_03643	ulaA	Ascorbate-specific PTS system, EIIC component
	CKO_03642	ulaB	Ascorbate-specific PTS system, EIIB component (EC 2.7.1.69)
	CKO_03641	ulaC	Ascorbate-specific PTS system, EIIA component (EC 2.7.1.-)
Position: -286 Score: 5.3 Sequence: CTAATTTTCAAAAGTAATCA Position: -44 Score: 4.3 Sequence: GGATTAATCAAAACAAATCA Locus tag: CKO_03645 Name: ulaG Funciton: Probable L-ascorbate-6-phosphate lactonase UlaG (EC 3.1.1.-) (L-ascorbate utilization protein G) Locus tag: CKO_03646 Name: ulaR Funciton: Ascorbate utilization transcriptional regulator UlaR, DeoR family
	CKO_03645	ulaG	Probable L-ascorbate-6-phosphate lactonase UlaG (EC 3.1.1.-) (L-ascorbate utilization protein G)
	CKO_03646	ulaR	Ascorbate utilization transcriptional regulator UlaR, DeoR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD