Regulog QorR - Frankineae/Propionibacterineae/Pseudonocardiaceae
| Regulator type: | Transcription factor |
| Regulator family: | HxlR |
| Regulation mode: | repressor |
| Biological process: | Energy metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Frankineae/Propionibacterineae/Pseudonocardiaceae
- By trascription factor - QorR
- By TF family - HxlR
- By pathway - Energy metabolism
| Genome | Genes | Operons |
|---|---|---|
| Saccharomonospora viridis DSM 43017 | ||
| Actinosynnema mirum DSM 43827 | ||
| Saccharopolyspora erythraea NRRL 2338 | 2 | 2 |
| Nakamurella multipartita DSM 44233 | ||
| Frankia sp. EAN1pec | 2 | 2 |
| Frankia sp. CcI3 | 2 | 2 |
| Acidothermus cellulolyticus 11B | ||
| Nocardioides sp. JS614 | ||
| Propionibacterium acnes KPA171202 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| qorB |
|
|
*
Saccharopolyspora erythraea NRRL 2338 Site: position = -51 score = 4.84642 sequence = CTGGTTACCAATCGATACCGT Gene: SACE_0813: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
|
*2
Frankia sp. EAN1pec Site: position = -89 score = 5.3251 sequence = CCGCTATCCGGGAGGTAACCG Gene: Franean1_1882: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) Gene: Franean1_1760: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
*
Frankia sp. CcI3 Site: position = -87 score = 5.8026 sequence = CCGGTATCCCCGCGGTAACCG Gene: Francci3_2018: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
|
|
|
Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2) |
| CRON 2. | ||||||||||
| qorR |
|
|
*
Saccharopolyspora erythraea NRRL 2338 Site: position = -47 score = 4.84642 sequence = ACGGTATCGATTGGTAACCAG Gene: SACE_0812: Redox-sensing transcriptional regulator QorR, HxlR family |
|
*
Frankia sp. EAN1pec Site: position = -34 score = 5.3251 sequence = CGGTTACCTCCCGGATAGCGG Gene: Franean1_1881: Redox-sensing transcriptional regulator QorR, HxlR family |
*
Frankia sp. CcI3 Site: position = -42 score = 5.8026 sequence = CGGTTACCGCGGGGATACCGG Gene: Francci3_2019: Redox-sensing transcriptional regulator QorR, HxlR family |
|
|
|
Redox-sensing transcriptional regulator QorR, HxlR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |