Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of PUR regulog to Pseudoalteromonas atlantica T6c

Reference regulog properties
Source regulog: PUR - Shewanellaceae
Regulator type: Transcription factor
Regulator family: [Other]
Regulation mode:
Biological process: Purine metabolism
Effector:
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Pseudoalteromonas atlantica T6c
Orthologous TF(s) No orthologous TFs found
Regulated genes 1
Built upon 60 sites [see more]
Predicted regulatory interactions in Pseudoalteromonas atlantica T6c
Locus tag Position Score Sequence
Position: -44
Score: 4.6
Sequence: TACAATTGCGCCGCAATAAA
Locus tag: Patl_3120
Patl_3120 -44 4.6 TACAATTGCGCCGCAATAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: guaB
Ortholog function: Inosine-5'-monophosphate dehydrogenase (EC 1.1.1.205)
Shewanella oneidensis MR-1 SO_3293 -59 4.5 TATAATCCCGCCGCAATATT
Shewanella putrefaciens CN-32 Sputcn32_2646 -58 4.5 TATAATCCCGCCGCAATATT
Shewanella sp W3-18-1 Sputw3181_1361 -58 4.5 TATAATCCCGCCGCAATATT
Shewanella sp ANA-3 Shewana3_1235 -59 4.5 TATAATCCCGCCGCAATATT
Shewanella sp MR-4 Shewmr4_1234 -59 4.5 TATAATCCCGCCGCAATATT
Shewanella sp MR-7 Shewmr7_1305 -59 4.5 TATAATCCCGCCGCAATATT
Shewanella baltica OS155 Sbal_2984 -58 4.5 TATAATCCCGCCGCAATATT
Shewanella denitrificans OS217 Sden_1269 -57 4.3 TATAATCTCGCCGCAATATT
Shewanella frigidimarina NCIMB 400 Sfri_1137 -55 4.3 TATAATCTCGCCGCAATATT
Shewanella amazonensis SB2B Sama_2359 -57 5.1 TATAATGCCGCCGCAATATT
Shewanella loihica PV-4 Shew_1297 -56 4.5 TATAATCCCGCCGCAATATT
Shewanella pealeana ATCC 700345 Spea_1313 -56 4.3 TATAATCTCGCCGCAATATT
Shewanella halifaxensis HAW-EB4 Shal_1376 -56 4.3 TATAATCTCGCCGCAATATT
Shewanella piezotolerans WP3 swp_1463 -56 4.3 TATAATCTCGCCGCAATATT
Shewanella sediminis HAW-EB3 Ssed_3124 -58 4.5 TATAATCCCGCCGCAATATT
Shewanella woodyi ATCC 51908 Swoo_1559 -57 4.5 TATAATCCCGCCGCAATATT