Propagation of MntR regulog to Bacillus cereus AH820
| Source regulog: | MntR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor (activator) |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus cereus AH820 |
| Orthologous TF(s) | BCAH820_4224 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -61
Score: 6.2 Sequence: AAAGTTTACCTAAGGAAACTTT
Locus tag: BCAH820_0769
|
||||
| BCAH820_0769 | -61 | 6.2 | AAAGTTTACCTAAGGAAACTTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: feoA | ||||
| Ortholog function: Ferrous iron transport protein A | ||||
| Bacillus cereus ATCC 14579 | BC0709 | -61 | 5.8 | AAAGTTTACCTTAGGAAACTTT |