Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MntR regulog to Bacillus cereus AH820

Reference regulog properties
Source regulog: MntR - Bacillales
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor (activator)
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus cereus AH820
Orthologous TF(s) BCAH820_4224
Regulated genes 2
Built upon 16 sites [see more]
Predicted regulatory interactions in Bacillus cereus AH820
Locus tag Position Score Sequence
Position: -61
Score: 6.2
Sequence: AAAGTTTACCTAAGGAAACTTT
Locus tag: BCAH820_0769
BCAH820_0769 -61 6.2 AAAGTTTACCTAAGGAAACTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: feoA
Ortholog function: Ferrous iron transport protein A
Bacillus cereus ATCC 14579 BC0709 -61 5.8 AAAGTTTACCTTAGGAAACTTT
© 2009-2020 RegPrecise