Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MntR regulog to Bacillus anthracis Tsiankovskii-I

Reference regulog properties
Source regulog: MntR - Bacillales
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor (activator)
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus anthracis Tsiankovskii-I
Orthologous TF(s) BantT_010100026302
Regulated genes 3
Built upon 16 sites [see more]
Predicted regulatory interactions in Bacillus anthracis Tsiankovskii-I
Locus tag Position Score Sequence
Position: -120
Score: 6.4
Sequence: AAAGTTTCCCTAAGGAAACTTA
Position: -61
Score: 6.1
Sequence: AAAGTTGCCTTAATGCAAAATA
Locus tag: BantT_010100002840
BantT_010100002840 -120 6.4 AAAGTTTCCCTAAGGAAACTTA
-61 6.1 AAAGTTGCCTTAATGCAAAATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntB
Ortholog function: Manganese ABC transporter (ATP-binding protein)
Bacillus pumilus SAFR-032 BPUM_3011 -119 5.8 AAAGTTTCCCTAAGGAAACAAA
Bacillus halodurans C-125 BH1389 -180 6.2 AAAGTTTACTTAGGGAAACTTT
Position: -129
Score: 6
Sequence: TAATTTGCACTAAGGAAACATT
Locus tag: BantT_010100012035
BantT_010100012035 -129 6 TAATTTGCACTAAGGAAACATT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntH
Ortholog function: Manganese transport protein MntH
Bacillus subtilis subsp. subtilis str. 168 BSU04360 -60 6 TAATTTGCCTTAAGGAAACTCT
Bacillus amyloliquefaciens FZB42 RBAM_004660 -65 5.7 TAATTTGCATCTAGGAAACTTT
Bacillus pumilus SAFR-032 BPUM_0413 -63 5.8 AAAATTGCATCAAGGAAACATT
Bacillus licheniformis DSM 13 BLi00526 -62 6.3 AAATTTGCACTAAGGAAACTTT
Bacillus cereus ATCC 14579 BC1803 -129 6.3 TAATTTGCATTAAGGAAACTTT
Position: -61
Score: 6.2
Sequence: AAAGTTTACCTAAGGAAACTTT
Locus tag: BantT_010100027873
BantT_010100027873 -61 6.2 AAAGTTTACCTAAGGAAACTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: feoA
Ortholog function: Ferrous iron transport protein A
Bacillus cereus ATCC 14579 BC0709 -61 5.8 AAAGTTTACCTTAGGAAACTTT