Propagation of GamR regulog to Bacillus subtilis subsp. subtilis str. SMY

Reference regulog properties
Source regulog:	GamR - Bacillales
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Glucosamine utilization
Effector:	Glucosamine-6-phosphate
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus subtilis subsp. subtilis str. SMY
Orthologous TF(s)	BsubsS_010100001334
Regulated genes	2

Built upon 25 sites [see more]

Predicted regulatory interactions in *Bacillus subtilis subsp. subtilis str. SMY*
	Locus tag	Position	Score	Sequence
Position: -52 Score: 5.9 Sequence: AAATTGGTCATAACAAATAT Locus tag: BsubsS_010100001329
	BsubsS_010100001329	-52	5.9	AAATTGGTCATAACAAATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: gamA
Ortholog function: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Bacillus subtilis subsp. subtilis str. 168	BSU02360	-75	5	AAATTCGTAATGACAAGTAT
		-52	5.9	AAATTGGTCATAACAAATAT

Position: -186 Score: 5.9 Sequence: ATATTTGTTATGACCAATTT Locus tag: BsubsS_010100001334
	BsubsS_010100001334	-186	5.9	ATATTTGTTATGACCAATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: gamR
Ortholog function: Predicted transcriptional regulator of glucosamine utilization, GntR family
Bacillus licheniformis DSM 13	BLi00336	-110	5.2	TAACATGTTATAACAAATTT
		-96	4.6	AAATTTGTCCATACATATTT
		-82	6.2	ATATTTGTTATAACAAATTG
Bacillus subtilis subsp. subtilis str. 168	BSU02370	-186	5.9	ATATTTGTTATGACCAATTT
		-163	5	ATACTTGTCATTACGAATTT
Oceanobacillus iheyensis HTE831	OB2272	-81	5.8	AAATTTGTTATAACACAATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --