Propagation of AcoR regulog to Bacillus subtilis subsp. subtilis str. SMY
Source regulog: | AcoR - Bacillales |
Regulator type: | Transcription factor |
Regulator family: | Fis |
Regulation mode: | activator |
Biological process: | Acetoin utilization |
Effector: | Acetoin |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Bacillus subtilis subsp. subtilis str. SMY |
Orthologous TF(s) | BsubsS_010100004499 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -129
Score: 8 Sequence: GACAAAACGAGACACACGTCTCAAACTGTCTC
Locus tag: BsubsS_010100004479
|
||||
BsubsS_010100004479 | -129 | 8 | GACAAAACGAGACACACGTCTCAAACTGTCTC | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: acoA | ||||
Ortholog function: Acetoin dehydrogenase E1 component alpha-subunit (EC 1.2.4.-) | ||||
Bacillus subtilis subsp. subtilis str. 168 | BSU08060 | -129 | 8 | GACAAAACGAGACACACGTCTCAAACTGTCTC |
Bacillus amyloliquefaciens FZB42 | RBAM_008300 | -129 | 8.1 | GACAAAATGAGACACCTGTCTCAAACTGTCTC |
Bacillus pumilus SAFR-032 | BPUM_0451 | -140 | 7.7 | GACAAATAGAGATTCAAGTCTCATTTTGTCTC |
Bacillus licheniformis DSM 13 | BLi00849 | -140 | 8 | GACAAATTGAGACATCTGTCTCGTTTTGTCTC |
Bacillus cereus ATCC 14579 | BC2779 | -135 | 7.8 | GACAAAACGAGACAAATGTCTCATTTTGTCCA |
Bacillus halodurans C-125 | BH1822 | -141 | 5.7 | GACAATGTGAGACGTAACAGTGTTGCTAGTTT |