Propagation of GlvR regulog to Bacillus subtilis subsp. subtilis str. SMY

Reference regulog properties
Source regulog:	GlvR - Bacillales
Regulator type:	Transcription factor
Regulator family:	RpiR
Regulation mode:	activator
Biological process:	Maltose utilization
Effector:	Maltose-6-phosphate
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus subtilis subsp. subtilis str. SMY
Orthologous TF(s)	BsubsS_010100004544
Regulated genes	1

Built upon 3 sites [see more]

Predicted regulatory interactions in *Bacillus subtilis subsp. subtilis str. SMY*
	Locus tag	Position	Score	Sequence
Position: -129 Score: 7.6 Sequence: GAGAAATTTCCCGCTCTATGGGAAAAA Locus tag: BsubsS_010100004539
	BsubsS_010100004539	-129	7.6	GAGAAATTTCCCGCTCTATGGGAAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: glvA
Ortholog function: Maltose-6'-phosphate glucosidase (EC 3.2.1.122)
Bacillus subtilis subsp. subtilis str. 168	BSU08180	-129	7.6	GAGAAATTTCCCGCTCTATGGGAAAAA
Bacillus amyloliquefaciens FZB42	RBAM_008360	-129	7.7	GGGAACTTTCCCGCTTTTTGAGAAAAA
Bacillus licheniformis DSM 13	BLi00855	-129	7.5	GGGAAAGTTCCCGTTTTTCGGGAAAAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --