Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of GlvR regulog to Bacillus subtilis subsp. subtilis str. JH642

Reference regulog properties
Source regulog: GlvR - Bacillales
Regulator type: Transcription factor
Regulator family: RpiR
Regulation mode: activator
Biological process: Maltose utilization
Effector: Maltose-6-phosphate
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus subtilis subsp. subtilis str. JH642
Orthologous TF(s) BsubsJ_010100004448
Regulated genes 1
Built upon 3 sites [see more]
Predicted regulatory interactions in Bacillus subtilis subsp. subtilis str. JH642
Locus tag Position Score Sequence
Position: -129
Score: 7.6
Sequence: GAGAAATTTCCCGCTCTATGGGAAAAA
Locus tag: BsubsJ_010100004443
BsubsJ_010100004443 -129 7.6 GAGAAATTTCCCGCTCTATGGGAAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: glvA
Ortholog function: Maltose-6'-phosphate glucosidase (EC 3.2.1.122)
Bacillus subtilis subsp. subtilis str. 168 BSU08180 -129 7.6 GAGAAATTTCCCGCTCTATGGGAAAAA
Bacillus amyloliquefaciens FZB42 RBAM_008360 -129 7.7 GGGAACTTTCCCGCTTTTTGAGAAAAA
Bacillus licheniformis DSM 13 BLi00855 -129 7.5 GGGAAAGTTCCCGTTTTTCGGGAAAAT