Propagation of Zur regulog to Alicyclobacillus acidocaldarius subsp. acidocaldarius DSM 446

Reference regulog properties
Source regulog:	Zur - Bacillales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Firmicutes
Propagated regulon:
Target genome	Alicyclobacillus acidocaldarius subsp. acidocaldarius DSM 446
Orthologous TF(s)	Aaci_2612
Regulated genes	1

Built upon 67 sites [see more]

Predicted regulatory interactions in *Alicyclobacillus acidocaldarius subsp. acidocaldarius DSM 446*
	Locus tag	Position	Score	Sequence
Position: -115 Score: 5.7 Sequence: CAAATCAGAACGATTCCGATTTG Position: -54 Score: 6.1 Sequence: TAAATCGGATTGATTTCGATTTA Locus tag: Aaci_2612
	Aaci_2612	-115	5.7	CAAATCAGAACGATTCCGATTTG
		-54	6.1	TAAATCGGATTGATTTCGATTTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: zur
Ortholog function: Zinc homeostasis transcriptional regulator Zur, Fur family
Bacillus pumilus SAFR-032	BPUM_2241	-46	5.4	TAAATCGTAATCATTCTTTTTAT
Anoxybacillus flavithermus WK1	Aflv_0869	-36	5.7	TGAATCGGAATCATTTTGAATTA
Geobacillus kaustophilus HTA426	GK2469	-39	5.8	CAAATCGGAATGATTCTGAATTA
Bacillus cereus ATCC 14579	BC4277	-39	6	TAAATCGGAATCATTCTGAATTA
Bacillus halodurans C-125	BH1396	-72	5	TAAATCGGAATGATTCTTAATAT
Bacillus clausii KSM-K16	ABC1704	-39	5.1	TAAATCGGAAGCATTCTGAATAA
Oceanobacillus iheyensis HTE831	OB2398	-297	6	TAATTCGTAACGATTCCTATTTA
		-274	5.1	CATTTCATAATCATTACGCTATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --