Propagation of CcpB regulog to Bacillus amyloliquefaciens FZB42

Reference regulog properties
Source regulog:	CcpB - Bacillales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Carbon catabolism
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Bacillus amyloliquefaciens FZB42
Orthologous TF(s)	RBAM_037940
Regulated genes	1

Built upon 3 sites [see more]

Predicted regulatory interactions in *Bacillus amyloliquefaciens FZB42*
	Locus tag	Position	Score	Sequence
Position: -80 Score: 6 Sequence: AACTAATGTGCAACATGACA Locus tag: RBAM_017350
	RBAM_017350	-80	6	AACTAATGTGCAACATGACA
Supported by regulated orthologs from reference regulons
Ortholog gene name: xylA
Ortholog function: Xylose isomerase (EC 5.3.1.5)
Bacillus subtilis subsp. subtilis str. 168	BSU17600	-51	5.7	AAATAAAATGCATCTGTATT
Bacillus amyloliquefaciens FZB42	RBAM_017350	-80	6	AACTAATGTGCAACATGACA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --