Propagation of MntR regulog to Bacillus amyloliquefaciens FZB42
| Source regulog: | MntR - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor (activator) |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Bacillus amyloliquefaciens FZB42 |
| Orthologous TF(s) | RBAM_022840 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -65
Score: 5.7 Sequence: TAATTTGCATCTAGGAAACTTT
Locus tag: RBAM_004660
|
||||
| RBAM_004660 | -65 | 5.7 | TAATTTGCATCTAGGAAACTTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: mntH | ||||
| Ortholog function: Manganese transport protein MntH | ||||
| Bacillus subtilis subsp. subtilis str. 168 | BSU04360 | -60 | 6 | TAATTTGCCTTAAGGAAACTCT |
| Bacillus amyloliquefaciens FZB42 | RBAM_004660 | -65 | 5.7 | TAATTTGCATCTAGGAAACTTT |
| Bacillus pumilus SAFR-032 | BPUM_0413 | -63 | 5.8 | AAAATTGCATCAAGGAAACATT |
| Bacillus licheniformis DSM 13 | BLi00526 | -62 | 6.3 | AAATTTGCACTAAGGAAACTTT |
| Bacillus cereus ATCC 14579 | BC1803 | -129 | 6.3 | TAATTTGCATTAAGGAAACTTT |