Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MntR regulog to Bacillus amyloliquefaciens FZB42

Reference regulog properties
Source regulog: MntR - Bacillales
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor (activator)
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Firmicutes
Propagated regulon:
Target genome Bacillus amyloliquefaciens FZB42
Orthologous TF(s) RBAM_022840
Regulated genes 1
Built upon 16 sites [see more]
Predicted regulatory interactions in Bacillus amyloliquefaciens FZB42
Locus tag Position Score Sequence
Position: -65
Score: 5.7
Sequence: TAATTTGCATCTAGGAAACTTT
Locus tag: RBAM_004660
RBAM_004660 -65 5.7 TAATTTGCATCTAGGAAACTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: mntH
Ortholog function: Manganese transport protein MntH
Bacillus subtilis subsp. subtilis str. 168 BSU04360 -60 6 TAATTTGCCTTAAGGAAACTCT
Bacillus amyloliquefaciens FZB42 RBAM_004660 -65 5.7 TAATTTGCATCTAGGAAACTTT
Bacillus pumilus SAFR-032 BPUM_0413 -63 5.8 AAAATTGCATCAAGGAAACATT
Bacillus licheniformis DSM 13 BLi00526 -62 6.3 AAATTTGCACTAAGGAAACTTT
Bacillus cereus ATCC 14579 BC1803 -129 6.3 TAATTTGCATTAAGGAAACTTT