Propagation of UlaR regulog to Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. CVM23701

Reference regulog properties
Source regulog:	UlaR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	DeoR
Regulation mode:	repressor
Biological process:	Ascorbate utilization
Effector:	Ascorbate-6-phosphate
Phylum:	Proteobacteria
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. CVM23701
Orthologous TF(s)	Sententer_010100026354
Regulated genes	2

Built upon 13 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. CVM23701*
	Locus tag	Position	Score	Sequence
Position: -302 Score: 5.4 Sequence: TTAATTTTCAAAAGTAATCA Position: -59 Score: 4.3 Sequence: GGATTAATCAAAACAAATCA Locus tag: Sententer_010100026359
	Sententer_010100026359	-302	5.4	TTAATTTTCAAAAGTAATCA
		-59	4.3	GGATTAATCAAAACAAATCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ulaG
Ortholog function: Probable L-ascorbate-6-phosphate lactonase UlaG (EC 3.1.1.-) (L-ascorbate utilization protein G)
Citrobacter koseri ATCC BAA-895	CKO_03645	-286	5.3	CTAATTTTCAAAAGTAATCA
		-44	4.3	GGATTAATCAAAACAAATCA
Edwardsiella tarda EIB202	ETAE_3290	-75	4.2	CTAGCAATCGTTAAAAATCA
Escherichia coli str. K-12 substr. MG1655	b4192	-292	5.3	CTAATTTTCAAAAGTAATCA
		-60	3.9	GGATTAATCAAAACCAATCA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_04585	-299	5.3	CTAATAATCAAAAATAATCA
		-32	4.5	TGATTACTATTGAAAATACG
Salmonella typhimurium LT2	STM4382	-59	4.3	GGATTAATCAAAACAAATCA

Position: -80 Score: 5.4 Sequence: TGATTACTTTTGAAAATTAA Locus tag: Sententer_010100026364
	Sententer_010100026364	-80	5.4	TGATTACTTTTGAAAATTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ulaA
Ortholog function: Ascorbate-specific PTS system, EIIC component
Citrobacter koseri ATCC BAA-895	CKO_03643	-82	5.3	TGATTACTTTTGAAAATTAG
Escherichia coli str. K-12 substr. MG1655	b4193	-82	5.3	TGATTACTTTTGAAAATTAG
Salmonella typhimurium LT2	STM4383.S	-80	5.4	TGATTACTTTTGAAAATTAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --