Propagation of NagC regulog to Buchnera aphidicola str. Bp (Baizongia pistaciae)

Reference regulog properties
Source regulog:	NagC - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor (activator)
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine-6-phosphate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Buchnera aphidicola str. Bp (Baizongia pistaciae)
Orthologous TF(s)	No orthologous TFs found
Regulated genes	1

Built upon 68 sites [see more]

Predicted regulatory interactions in *Buchnera aphidicola str. Bp (Baizongia pistaciae)*
	Locus tag	Position	Score	Sequence
Position: -104 Score: 4.9 Sequence: CTAAATTTTTTACGAAAATTAAA Locus tag: bbp029
	bbp029	-104	4.9	CTAAATTTTTTACGAAAATTAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: glmU
Ortholog function: N-acetylglucosamine-1-phosphate uridyltransferase (EC 2.7.7.23) / Glucosamine-1-phosphate N-acetyltransferase (EC 2.3.1.157)
Escherichia coli str. K-12 substr. MG1655	b3730	-233	4.8	GTTTATTCATTGATCGAAATAAG
Salmonella typhimurium LT2	STM3862	-233	4.8	CTTTATTTATGGAGTAAAAAAAC
Citrobacter koseri ATCC BAA-895	CKO_00067	-233	4.8	CTTTATTCATGGGTCAAAAAAAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_04135	-248	4.7	CTTTATTCAGGTGGCGAAAAAAC
Enterobacter sp. 638	Ent638_4135	-233	5.2	CTTTATTCATGAGGCGAAAAAAT
Yersinia pestis KIM	y4133	-235	4.8	CTTGTTTTCTGTCGTAAAATAAG
Serratia proteamaculans 568	Spro_0010	-242	5	CTTTTTTTTTGTTTTAAAATAAG
Proteus mirabilis HI4320	PMI3066	-84	5.3	AATATTTTGTGTAACGAAATATG
Photorhabdus luminescens subsp. laumondii TTO1	plu0038	-85	4.7	GCTTTTTTGTATTGCGAAATATG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --