Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of EbgR regulog to Shigella sonnei Ss046

Reference regulog properties
Source regulog: EbgR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Shigella sonnei Ss046
Orthologous TF(s) SSO_3213
Regulated genes 2
Built upon 5 sites [see more]
Predicted regulatory interactions in Shigella sonnei Ss046
Locus tag Position Score Sequence
Position: -201
Score: 5.7
Sequence: TAAAATTTTACTAAACTATAG
Locus tag: SSO_3213
SSO_3213 -201 5.7 TAAAATTTTACTAAACTATAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: ebgR
Ortholog function: Evolved beta-D-galactosidase transcriptional repressor, LacI family
Escherichia coli str. K-12 substr. MG1655 b3075 -201 5.7 TAAAATTTTACTAAACTATAG
Serratia proteamaculans 568 Spro_1972 -223 5.9 AAAATATTTAGTAAAAAATAC
© 2009-2020 RegPrecise