Propagation of UlaR regulog to Edwardsiella tarda EIB202
| Source regulog: | UlaR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | DeoR |
| Regulation mode: | repressor |
| Biological process: | Ascorbate utilization |
| Effector: | Ascorbate-6-phosphate |
| Phylum: | Proteobacteria |
| Propagated regulon: | |
| Target genome | Edwardsiella tarda EIB202 |
| Orthologous TF(s) | ETAE_3289 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -96
Score: 4.2 Sequence: TGATTTTTAACGATTGCTAG
Locus tag: ETAE_3292
|
||||
| ETAE_3292 | -96 | 4.2 | TGATTTTTAACGATTGCTAG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ulaA | ||||
| Ortholog function: Ascorbate-specific PTS system, EIIC component | ||||
| Edwardsiella tarda EIB202 | ETAE_3292 | -96 | 4.2 | TGATTTTTAACGATTGCTAG |