Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of UlaR regulog to Edwardsiella tarda EIB202

Reference regulog properties
Source regulog: UlaR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: DeoR
Regulation mode: repressor
Biological process: Ascorbate utilization
Effector: Ascorbate-6-phosphate
Phylum: Proteobacteria
Propagated regulon:
Target genome Edwardsiella tarda EIB202
Orthologous TF(s) ETAE_3289
Regulated genes 1
Built upon 13 sites [see more]
Predicted regulatory interactions in Edwardsiella tarda EIB202
Locus tag Position Score Sequence
Position: -96
Score: 4.2
Sequence: TGATTTTTAACGATTGCTAG
Locus tag: ETAE_3292
ETAE_3292 -96 4.2 TGATTTTTAACGATTGCTAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: ulaA
Ortholog function: Ascorbate-specific PTS system, EIIC component
Edwardsiella tarda EIB202 ETAE_3292 -96 4.2 TGATTTTTAACGATTGCTAG
© 2009-2020 RegPrecise