Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SorC regulog to Klebsiella pneumoniae 342

Reference regulog properties
Source regulog: SorC - Enterobacteriales
Regulator type: Transcription factor
Regulator family: SorC
Regulation mode: activator (repressor)
Biological process: Sorbose utilization
Effector: Sorbose
Phylum: Proteobacteria
Propagated regulon:
Target genome Klebsiella pneumoniae 342
Orthologous TF(s) KPK_5266
Regulated genes 1
Built upon 1 sites [see more]
Predicted regulatory interactions in Klebsiella pneumoniae 342
Locus tag Position Score Sequence
Position: -28
Score: 6.5
Sequence: ATTTGCACAAATGTGCAGGA
Locus tag: KPK_5266
KPK_5266 -28 6.5 ATTTGCACAAATGTGCAGGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: sorC
Ortholog function: Sorbitol utilization transcriptional regulator, SorC family
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04408 -28 6.5 ATTTGCACAAATGTGCAGGA