Propagation of ScrR regulog to Streptococcus pneumoniae Hungary19A-6
| Source regulog: | ScrR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose-6-phosphate |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Streptococcus pneumoniae Hungary19A-6 |
| Orthologous TF(s) | No orthologous TFs found |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -109
Score: 6.2 Sequence: TCTGCAAAACGCTTGACATA
Locus tag: SPH_1830
|
||||
| SPH_1830 | -109 | 6.2 | TCTGCAAAACGCTTGACATA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: scrA | ||||
| Ortholog function: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69) | ||||
| Streptococcus agalactiae 2603V/R | SAG1690 | -93 | 6.8 | TATGTCAAACGCTTGACATA |
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | SDEG_1871 | -152 | 6.8 | TATGTCAAACGCTTGACATA |
| Streptococcus equi subsp. zooepidemicus MGCS10565 | Sez_0363 | -185 | 6.8 | TATGTCAAACGCTTGACATA |
| Streptococcus gordonii str. Challis substr. CH1 | SGO_1857 | -108 | 6.2 | TCTGCAAAACGCTTGACATA |
| Streptococcus mitis B6 | smi_1615 | -108 | 6.2 | TCTGCAAAACGCTTGACATA |
| Streptococcus pneumoniae TIGR4 | SP_1722 | -109 | 6.2 | TCTGCAAAACGCTTGACATA |
| Streptococcus pyogenes M1 GAS | SPy1815 | -152 | 6.2 | TATGTTAGGCGCTTGACATA |
| Streptococcus sanguinis SK36 | SSA_0456 | -104 | 6.2 | TCTGCAAAACGCTTGACATA |
| Streptococcus suis 05ZYH33 | SSU05_1817 | -107 | 6.1 | TGTGATAAACGTTTGACATA |
| Streptococcus thermophilus CNRZ1066 | str1734 | -156 | 6.1 | AATGCTAAACGTTTGACATA |
| Streptococcus uberis 0140J | SUB1543 | -96 | 6.8 | TATGTCAAACGCTTGACATA |