Propagation of FlpA regulog to Lactococcus lactis subsp. lactis KF147
| Source regulog: | FlpA - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator (repressor) |
| Biological process: | Heavy metal resistance |
| Effector: | Oxygen |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactococcus lactis subsp. lactis KF147 |
| Orthologous TF(s) | LLKF_p0033 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -88
Score: 5.7 Sequence: TTCTTGATGTAAATCAATGT
Locus tag: LLKF_2310
|
||||
| LLKF_2310 | -88 | 5.7 | TTCTTGATGTAAATCAATGT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: copZ | ||||
| Ortholog function: Copper chaperone | ||||
| Lactococcus lactis subsp. cremoris SK11 | LACR_1043 | -76 | 6 | TAATTGATACAAATCAATTT |
| Lactococcus lactis subsp. lactis Il1403 | L134080 | -88 | 5.7 | TTCTTGATGTAAATCAATGT |