Propagation of FlpA regulog to Lactococcus lactis subsp. lactis KF147

Reference regulog properties
Source regulog:	FlpA - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Heavy metal resistance
Effector:	Oxygen
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactococcus lactis subsp. lactis KF147
Orthologous TF(s)	LLKF_p0033
Regulated genes	1

Built upon 4 sites [see more]

Predicted regulatory interactions in *Lactococcus lactis subsp. lactis KF147*
	Locus tag	Position	Score	Sequence
Position: -88 Score: 5.7 Sequence: TTCTTGATGTAAATCAATGT Locus tag: LLKF_2310
	LLKF_2310	-88	5.7	TTCTTGATGTAAATCAATGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: copZ
Ortholog function: Copper chaperone
Lactococcus lactis subsp. cremoris SK11	LACR_1043	-76	6	TAATTGATACAAATCAATTT
Lactococcus lactis subsp. lactis Il1403	L134080	-88	5.7	TTCTTGATGTAAATCAATGT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --