Propagation of MalR regulog to Lactococcus lactis subsp. lactis KF147
| Source regulog: | MalR - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Maltose utilization; Maltodextrin utilization |
| Effector: | Maltose |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactococcus lactis subsp. lactis KF147 |
| Orthologous TF(s) | LLKF_1835 |
| Regulated genes | 2 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -187
Score: 5.5 Sequence: TGTCGCAAACGGTTGCGTCA
Locus tag: LLKF_1841
|
||||
| LLKF_1841 | -187 | 5.5 | TGTCGCAAACGGTTGCGTCA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: nepU | ||||
| Ortholog function: Neopullulanase (EC 3.2.1.135) | ||||
| Lactococcus lactis subsp. cremoris SK11 | LACR_1852 | -191 | 5.7 | ATTCGCAAACGGTTGCGTCA |
| Lactococcus lactis subsp. lactis Il1403 | L128694 | -187 | 5.5 | TGTCGCAAACGGTTGCGTCA |
| Streptococcus gordonii str. Challis substr. CH1 | SGO_1351 | -52 | 5.7 | TTATGAAAACGTTTGCTTTA |
| Streptococcus mitis B6 | smi_1104 | -51 | 6.3 | TTATGAAAACGTTTGCGTAA |
|
Position: -68
Score: 6.1 Sequence: AAAAGCAAACGGTTGCGTAA
Locus tag: LLKF_1842
|
||||
| LLKF_1842 | -68 | 6.1 | AAAAGCAAACGGTTGCGTAA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: malE | ||||
| Ortholog function: Maltose/maltodextrin ABC transporter, substrate-binding protein | ||||
| Lactococcus lactis subsp. cremoris SK11 | LACR_1853 | -68 | 6.1 | AAAAGCAAACGGTTGCGTAA |
| Lactococcus lactis subsp. lactis Il1403 | L128695 | -68 | 5.6 | AAAAGCAAACGGTTGTGTAA |
| Streptococcus agalactiae 2603V/R | SAG1441 | -60 | 6.1 | TTTTGCAAACGGTTGCATAA |
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | SDEG_1296 | -58 | 6 | TTCTGCAAGCGGTTGCATAA |
| Streptococcus equi subsp. zooepidemicus MGCS10565 | Sez_1257 | -58 | 6 | TTCTGCAAGCGGTTGCATAA |
| Streptococcus gallolyticus UCN34 | GALLO_1399 | -68 | 5.9 | TCCTGCAAACGGTTGCATAA |
| Streptococcus mutans UA159 | SMU.1568 | -66 | 6 | TTTCGCAAACGATTGCATAA |
| Streptococcus pyogenes M1 GAS | SPy1294 | -58 | 6 | TTCTGCAAGCGGTTGCATAA |
| Streptococcus sanguinis SK36 | SSA_1298 | -56 | 6 | AATTGCAAACGGTTGCATAA |
| Streptococcus uberis 0140J | SUB1143 | -55 | 6.2 | TTCTGCAAACGGTTGCATAA |