Propagation of MalR regulog to Streptococcus thermophilus LMG 18311

Reference regulog properties
Source regulog:	MalR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization; Maltodextrin utilization
Effector:	Maltose
Phylum:	Firmicutes
Propagated regulon:
Target genome	Streptococcus thermophilus LMG 18311
Orthologous TF(s)	stu1014
Regulated genes	4

Built upon 80 sites [see more]

Predicted regulatory interactions in *Streptococcus thermophilus LMG 18311*
	Locus tag	Position	Score	Sequence
Position: -57 Score: 5.6 Sequence: ACGTGCAACCGTTTGCATTA Locus tag: stu1013
	stu1013	-57	5.6	ACGTGCAACCGTTTGCATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: malM
Ortholog function: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
Streptococcus agalactiae 2603V/R	SAG1439	-61	5.8	TTATGCAATCGCTTGCGTTA
Streptococcus dysgalactiae subsp. equisimilis GGS_124	SDEG_1293	-59	6.4	TTACGCAAACGGTTGCGTTA
Streptococcus equi subsp. zooepidemicus MGCS10565	Sez_1255	-84	6.1	TTGCGCAAACGGTTGCGTTA
Streptococcus gallolyticus UCN34	GALLO_1397	-60	6.1	TTACGCAAACGGTTGCGCTA
Streptococcus mutans UA159	SMU.1565	-61	6.4	TTATGCAAACGATTGCGTTA
Streptococcus pyogenes M1 GAS	SPy1292	-58	6	TTACGCAAGCGCTTGCGTTA
Streptococcus suis 05ZYH33	SSU05_0392	-57	6.2	AAGTGCAAACGTTTGCGTTA
Streptococcus thermophilus CNRZ1066	str1013	-57	5.6	ACGTGCAACCGTTTGCATTA
Streptococcus uberis 0140J	SUB1141	-56	6.4	TTACGCAAACGGTTGCGTTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --