Propagation of ScrR regulog to Streptococcus pneumoniae CDC1087-00
Source regulog: | ScrR - Streptococcaceae |
Regulator type: | Transcription factor |
Regulator family: | LacI |
Regulation mode: | repressor |
Biological process: | Sucrose utilization |
Effector: | Sucrose-6-phosphate |
Phylum: | Firmicutes |
Propagated regulon: | |
Target genome | Streptococcus pneumoniae CDC1087-00 |
Orthologous TF(s) | SpneCDC_010100004893 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -109
Score: 6.5 Sequence: TATGCAAAACGCTTGACATA
Locus tag: SpneCDC_010100004908
|
||||
SpneCDC_010100004908 | -109 | 6.5 | TATGCAAAACGCTTGACATA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: scrA | ||||
Ortholog function: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69) | ||||
Streptococcus agalactiae 2603V/R | SAG1690 | -93 | 6.8 | TATGTCAAACGCTTGACATA |
Streptococcus dysgalactiae subsp. equisimilis GGS_124 | SDEG_1871 | -152 | 6.8 | TATGTCAAACGCTTGACATA |
Streptococcus equi subsp. zooepidemicus MGCS10565 | Sez_0363 | -185 | 6.8 | TATGTCAAACGCTTGACATA |
Streptococcus gordonii str. Challis substr. CH1 | SGO_1857 | -108 | 6.2 | TCTGCAAAACGCTTGACATA |
Streptococcus mitis B6 | smi_1615 | -108 | 6.2 | TCTGCAAAACGCTTGACATA |
Streptococcus pneumoniae TIGR4 | SP_1722 | -109 | 6.2 | TCTGCAAAACGCTTGACATA |
Streptococcus pyogenes M1 GAS | SPy1815 | -152 | 6.2 | TATGTTAGGCGCTTGACATA |
Streptococcus sanguinis SK36 | SSA_0456 | -104 | 6.2 | TCTGCAAAACGCTTGACATA |
Streptococcus suis 05ZYH33 | SSU05_1817 | -107 | 6.1 | TGTGATAAACGTTTGACATA |
Streptococcus thermophilus CNRZ1066 | str1734 | -156 | 6.1 | AATGCTAAACGTTTGACATA |
Streptococcus uberis 0140J | SUB1543 | -96 | 6.8 | TATGTCAAACGCTTGACATA |