Propagation of FlpA regulog to Lactococcus lactis subsp. cremoris SK11

Reference regulog properties
Source regulog:	FlpA - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	CRP
Regulation mode:	activator (repressor)
Biological process:	Heavy metal resistance
Effector:	Oxygen
Phylum:	Firmicutes
Propagated regulon:
Target genome	Lactococcus lactis subsp. cremoris SK11
Orthologous TF(s)	LACR_1045
Regulated genes	1

Built upon 4 sites [see more]

Predicted regulatory interactions in *Lactococcus lactis subsp. cremoris SK11*
	Locus tag	Position	Score	Sequence
Position: -75 Score: 5.8 Sequence: TTATTGACAGAAATCAATTT Locus tag: LACR_1042
	LACR_1042	-75	5.8	TTATTGACAGAAATCAATTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: cadA
Ortholog function: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-)
Lactococcus lactis subsp. cremoris SK11	LACR_1042	-75	5.8	TTATTGACAGAAATCAATTT
Lactococcus lactis subsp. lactis Il1403	L63697	-74	5.8	TTCTTGATGGCTATCAATTT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --