Propagation of FlpA regulog to Lactococcus lactis subsp. cremoris SK11
| Source regulog: | FlpA - Streptococcaceae |
| Regulator type: | Transcription factor |
| Regulator family: | CRP |
| Regulation mode: | activator (repressor) |
| Biological process: | Heavy metal resistance |
| Effector: | Oxygen |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Lactococcus lactis subsp. cremoris SK11 |
| Orthologous TF(s) | LACR_1045 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -75
Score: 5.8 Sequence: TTATTGACAGAAATCAATTT
Locus tag: LACR_1042
|
||||
| LACR_1042 | -75 | 5.8 | TTATTGACAGAAATCAATTT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: cadA | ||||
| Ortholog function: Lead, cadmium, zinc and mercury transporting ATPase (EC:3.6.3.-) | ||||
| Lactococcus lactis subsp. cremoris SK11 | LACR_1042 | -75 | 5.8 | TTATTGACAGAAATCAATTT |
| Lactococcus lactis subsp. lactis Il1403 | L63697 | -74 | 5.8 | TTCTTGATGGCTATCAATTT |