Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of ScrR regulog to Streptococcus pneumoniae TIGR4

Reference regulog properties
Source regulog: ScrR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Phylum: Firmicutes
Propagated regulon:
Target genome Streptococcus pneumoniae TIGR4
Orthologous TF(s) SP_1725
Regulated genes 1
Built upon 27 sites [see more]
Predicted regulatory interactions in Streptococcus pneumoniae TIGR4
Locus tag Position Score Sequence
Position: -109
Score: 6.2
Sequence: TCTGCAAAACGCTTGACATA
Locus tag: SP_1722
SP_1722 -109 6.2 TCTGCAAAACGCTTGACATA
Supported by regulated orthologs from reference regulons
Ortholog gene name: scrA
Ortholog function: Sucrose-specific PTS system, EIIABC component (EC 2.7.1.69)
Streptococcus agalactiae 2603V/R SAG1690 -93 6.8 TATGTCAAACGCTTGACATA
Streptococcus dysgalactiae subsp. equisimilis GGS_124 SDEG_1871 -152 6.8 TATGTCAAACGCTTGACATA
Streptococcus equi subsp. zooepidemicus MGCS10565 Sez_0363 -185 6.8 TATGTCAAACGCTTGACATA
Streptococcus gordonii str. Challis substr. CH1 SGO_1857 -108 6.2 TCTGCAAAACGCTTGACATA
Streptococcus mitis B6 smi_1615 -108 6.2 TCTGCAAAACGCTTGACATA
Streptococcus pneumoniae TIGR4 SP_1722 -109 6.2 TCTGCAAAACGCTTGACATA
Streptococcus pyogenes M1 GAS SPy1815 -152 6.2 TATGTTAGGCGCTTGACATA
Streptococcus sanguinis SK36 SSA_0456 -104 6.2 TCTGCAAAACGCTTGACATA
Streptococcus suis 05ZYH33 SSU05_1817 -107 6.1 TGTGATAAACGTTTGACATA
Streptococcus thermophilus CNRZ1066 str1734 -156 6.1 AATGCTAAACGTTTGACATA
Streptococcus uberis 0140J SUB1543 -96 6.8 TATGTCAAACGCTTGACATA