Propagation of BfrR regulog to Streptococcus suis 05ZYH33

Reference regulog properties
Source regulog:	BfrR - Streptococcaceae
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Fructooligosaccharides utilization
Effector:
Phylum:	Firmicutes
Propagated regulon:
Target genome	Streptococcus suis 05ZYH33
Orthologous TF(s)	SSU05_1341
Regulated genes	1

Built upon 7 sites [see more]

Predicted regulatory interactions in *Streptococcus suis 05ZYH33*
	Locus tag	Position	Score	Sequence
Position: -33 Score: 6.1 Sequence: TTATTGAAACGTTTCACAAG Locus tag: SSU05_1341
	SSU05_1341	-33	6.1	TTATTGAAACGTTTCACAAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: bfrR
Ortholog function: Fructooligosaccharides utilization transcriptional regulator BfrR, LacI family
Streptococcus suis 05ZYH33	SSU05_1341	-33	6.1	TTATTGAAACGTTTCACAAG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --