Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of MalR regulog to Streptococcus thermophilus LMD-9

Reference regulog properties
Source regulog: MalR - Streptococcaceae
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Maltose utilization; Maltodextrin utilization
Effector: Maltose
Phylum: Firmicutes
Propagated regulon:
Target genome Streptococcus thermophilus LMD-9
Orthologous TF(s) No orthologous TFs found
Regulated genes 1
Built upon 80 sites [see more]
Predicted regulatory interactions in Streptococcus thermophilus LMD-9
Locus tag Position Score Sequence
Position: -84
Score: 5.6
Sequence: ACGTGCAACCGTTTGCATTA
Locus tag: STER_1017
STER_1017 -84 5.6 ACGTGCAACCGTTTGCATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: malM
Ortholog function: 4-alpha-glucanotransferase (amylomaltase) (EC 2.4.1.25)
Streptococcus agalactiae 2603V/R SAG1439 -61 5.8 TTATGCAATCGCTTGCGTTA
Streptococcus dysgalactiae subsp. equisimilis GGS_124 SDEG_1293 -59 6.4 TTACGCAAACGGTTGCGTTA
Streptococcus equi subsp. zooepidemicus MGCS10565 Sez_1255 -84 6.1 TTGCGCAAACGGTTGCGTTA
Streptococcus gallolyticus UCN34 GALLO_1397 -60 6.1 TTACGCAAACGGTTGCGCTA
Streptococcus mutans UA159 SMU.1565 -61 6.4 TTATGCAAACGATTGCGTTA
Streptococcus pyogenes M1 GAS SPy1292 -58 6 TTACGCAAGCGCTTGCGTTA
Streptococcus suis 05ZYH33 SSU05_0392 -57 6.2 AAGTGCAAACGTTTGCGTTA
Streptococcus thermophilus CNRZ1066 str1013 -57 5.6 ACGTGCAACCGTTTGCATTA
Streptococcus uberis 0140J SUB1141 -56 6.4 TTACGCAAACGGTTGCGTTA