Propagation of Zur regulog to Geobacillus kaustophilus HTA426
| Source regulog: | Zur - Bacillales |
| Regulator type: | Transcription factor |
| Regulator family: | FUR |
| Regulation mode: | repressor |
| Biological process: | Zinc homeostasis |
| Effector: | Zinc ion, (Zn2+) |
| Phylum: | Firmicutes |
| Propagated regulon: | |
| Target genome | Geobacillus kaustophilus HTA426 |
| Orthologous TF(s) | GK2469 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -39
Score: 5.8 Sequence: CAAATCGGAATGATTCTGAATTA
Locus tag: GK2471
|
||||
| GK2471 | -39 | 5.8 | CAAATCGGAATGATTCTGAATTA | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: znuC | ||||
| Ortholog function: Zinc ABC transporter, ATP-binding protein ZnuC | ||||
| Bacillus pumilus SAFR-032 | BPUM_2243 | -46 | 5.4 | TAAATCGTAATCATTCTTTTTAT |
| Anoxybacillus flavithermus WK1 | Aflv_0867 | -36 | 5.7 | TGAATCGGAATCATTTTGAATTA |
| Geobacillus kaustophilus HTA426 | GK2471 | -39 | 5.8 | CAAATCGGAATGATTCTGAATTA |
| Bacillus cereus ATCC 14579 | BC4279 | -39 | 6 | TAAATCGGAATCATTCTGAATTA |
| Bacillus halodurans C-125 | BH1394 | -72 | 5 | TAAATCGGAATGATTCTTAATAT |
| Bacillus clausii KSM-K16 | ABC1702 | -39 | 5.1 | TAAATCGGAAGCATTCTGAATAA |
| Oceanobacillus iheyensis HTE831 | OB2396 | -297 | 6 | TAATTCGTAACGATTCCTATTTA |
| -274 | 5.1 | CATTTCATAATCATTACGCTATT | ||