Propagation of NrtR regulog to Thermosynechococcus elongatus BP-1

Reference regulog properties
Source regulog:	NrtR - Cyanobacteria
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Cyanobacteria
Propagated regulon:
Target genome	Thermosynechococcus elongatus BP-1
Orthologous TF(s)	tlr1179
Regulated genes	1

Built upon 17 sites [see more]

Predicted regulatory interactions in *Thermosynechococcus elongatus BP-1*
	Locus tag	Position	Score	Sequence
Position: -48 Score: 6.3 Sequence: TTATGGTGAAACTCACTATAA Locus tag: tlr1177
	tlr1177	-48	6.3	TTATGGTGAAACTCACTATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: pncB
Ortholog function: Nicotinate phosphoribosyltransferase (EC 2.4.2.11)
Cyanothece sp. ATCC 51142	cce_2759	-49	5.9	TTTTGGTAAAAGTTACTATAA
Cyanothece sp. PCC 8801	PCC8801_0271	-74	6	TTTTGGTAAAAACTACTATAA
Cyanothece sp. PCC 7425	Cyan7425_2236	-50	6.1	TTATGGTAGAAACTACTATAA
Nostoc sp. PCC 7120	alr2482	-53	6.4	TTATGGTAAATTCTACCATAA
Trichodesmium erythraeum IMS101	Tery_0318	-173	5.9	ATATAGTAAGAATAACTATAA
Thermosynechococcus elongatus BP-1	tlr1177	-48	6.3	TTATGGTGAAACTCACTATAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --