Propagation of NrtR regulog to Cyanothece sp. PCC 7425

Reference regulog properties
Source regulog:	NrtR - Cyanobacteria
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Cyanobacteria
Propagated regulon:
Target genome	Cyanothece sp. PCC 7425
Orthologous TF(s)	Cyan7425_2238
Regulated genes	1

Built upon 17 sites [see more]

Predicted regulatory interactions in *Cyanothece sp. PCC 7425*
	Locus tag	Position	Score	Sequence
Position: -53 Score: 5.7 Sequence: TTTTGGTAAATTCGACTATAA Locus tag: Cyan7425_4975
	Cyan7425_4975	-53	5.7	TTTTGGTAAATTCGACTATAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: nadA
Ortholog function: Quinolinate synthetase (EC 4.1.99.-)
Synechocystis sp. PCC 6803	sll0622	-43	6.1	TTATGGTAGTTTTAACTATAA
Cyanothece sp. ATCC 51142	cce_3716	-24	5.8	TTTTGGTAAGATCAACTATAA
Cyanothece sp. PCC 8801	PCC8801_0787	-44	6.1	TTATGGTAAAAACAACTATAA
Cyanothece sp. PCC 7425	Cyan7425_4975	-53	5.7	TTTTGGTAAATTCGACTATAA
Microcystis aeruginosa NIES-843	MAE_32960	-29	5.8	ATTTGGTAAAAATAACCATAA
Nostoc sp. PCC 7120	all4673	-64	6	TTTTGGTAAAAACTACTATAA
Trichodesmium erythraeum IMS101	Tery_2446	-85	4.6	TTATAGTATAATTCATCAAAC
Thermosynechococcus elongatus BP-1	null	-67	5.8	TTTTGGTAAAAGTCACTATAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --