Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of ModE regulog to Yersinia pestis Z176003

Reference regulog properties
Source regulog: ModE - Enterobacteriales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Yersinia pestis Z176003
Orthologous TF(s) YPZ3_1036
Regulated genes 2
Built upon 55 sites [see more]
Predicted regulatory interactions in Yersinia pestis Z176003
Locus tag Position Score Sequence
Position: -47
Score: 6
Sequence: CGCTATATTCCTCCGTATATAACG
Locus tag: YPZ3_1037
YPZ3_1037 -47 6 CGCTATATTCCTCCGTATATAACG
Supported by regulated orthologs from reference regulons
Ortholog gene name: modA
Ortholog function: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Escherichia coli str. K-12 substr. MG1655 b0763 -43 6.2 CGTTATATTGTCGCCTACATAACG
Salmonella typhimurium LT2 STM0781 -44 6.6 CGTTATATTATCGTTTACATAACG
Citrobacter koseri ATCC BAA-895 CKO_02372 -43 6.3 CGCTATATTTGCGCCTACATAACG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00777 -42 6.6 CGTTATATTATCGACTACATAACG
Enterobacter sp. 638 Ent638_1254 -43 6.6 CGTTATATTTATTTGTATATAACG
Erwinia amylovora ATCC 49946 EAM_1202 -44 6 CGTTATATCATCATATATATAGCG
Yersinia pestis KIM y3037 -35 6 CGCTATATTCCTCCGTATATAACG
Serratia proteamaculans 568 Spro_1303 -60 6.7 CGTTATATTATTTTTTATATAACG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1393 -44 6.4 CGTTATATTATTATTTACACAACG
Edwardsiella tarda EIB202 ETAE_2559 -48 6.3 CGCCATATAATCGATTATACAACG
Proteus mirabilis HI4320 PMI0597 -108 6 CGCTATATTTATTGATATATAACC
-55 5.6 CGTTATATCTTGATATATACAGCG
Position: -282
Score: 5.1
Sequence: CGTTATATATATTAAGTGATAACG
Locus tag: YPZ3_2678
YPZ3_2678 -282 5.1 CGTTATATATATTAAGTGATAACG
Supported by regulated orthologs from reference regulons
Ortholog gene name: napF
Ortholog function: ferredoxin-type protein, predicted role in electron transfer to periplasmic nitrate reductase (NapA)
Escherichia coli str. K-12 substr. MG1655 b2208 -221 5.7 CGCTATATAAATATATTTATAACC
Salmonella typhimurium LT2 STM2261 -225 6.3 CGTTATATAAATATCTATATAACT
Yersinia pestis KIM y1442 -282 5.1 CGTTATATATATTAAGTGATAACG
Serratia proteamaculans 568 Spro_3488 -422 6.1 CGCTGTATAATCAACTAGATAGCG
Edwardsiella tarda EIB202 ETAE_1114 -246 6 CGCTGTATATTTAAGTAAATAGCG