Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of ModE regulog to Enterobacter cancerogenus ATCC 35316

Reference regulog properties
Source regulog: ModE - Enterobacteriales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Enterobacter cancerogenus ATCC 35316
Orthologous TF(s) ENTCAN_01469
Regulated genes 4
Built upon 55 sites [see more]
Predicted regulatory interactions in Enterobacter cancerogenus ATCC 35316
Locus tag Position Score Sequence
Position: -43
Score: 6.6
Sequence: CGTTATATTTATATGTATATAACG
Locus tag: ENTCAN_01471
ENTCAN_01471 -43 6.6 CGTTATATTTATATGTATATAACG
Supported by regulated orthologs from reference regulons
Ortholog gene name: modA
Ortholog function: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Escherichia coli str. K-12 substr. MG1655 b0763 -43 6.2 CGTTATATTGTCGCCTACATAACG
Salmonella typhimurium LT2 STM0781 -44 6.6 CGTTATATTATCGTTTACATAACG
Citrobacter koseri ATCC BAA-895 CKO_02372 -43 6.3 CGCTATATTTGCGCCTACATAACG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00777 -42 6.6 CGTTATATTATCGACTACATAACG
Enterobacter sp. 638 Ent638_1254 -43 6.6 CGTTATATTTATTTGTATATAACG
Erwinia amylovora ATCC 49946 EAM_1202 -44 6 CGTTATATCATCATATATATAGCG
Yersinia pestis KIM y3037 -35 6 CGCTATATTCCTCCGTATATAACG
Serratia proteamaculans 568 Spro_1303 -60 6.7 CGTTATATTATTTTTTATATAACG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA1393 -44 6.4 CGTTATATTATTATTTACACAACG
Edwardsiella tarda EIB202 ETAE_2559 -48 6.3 CGCCATATAATCGATTATACAACG
Proteus mirabilis HI4320 PMI0597 -108 6 CGCTATATTTATTGATATATAACC
-55 5.6 CGTTATATCTTGATATATACAGCG
Position: -38
Score: 6.4
Sequence: CGCTATATAATTTTATATACAACG
Locus tag: ENTCAN_04327
ENTCAN_04327 -38 6.4 CGCTATATAATTTTATATACAACG
Supported by regulated orthologs from reference regulons
Ortholog gene name: yghW
Ortholog function: hypothetical protein
Escherichia coli str. K-12 substr. MG1655 b2998 -37 6.2 CGCTATATATGACAATATATAGCG
Salmonella typhimurium LT2 STM3151 -38 6.9 CGCTATATAATTTATTATATAGCG
Citrobacter koseri ATCC BAA-895 CKO_04392 -36 6.5 CGCTATATAATTTGTTATATAGCG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03420 -38 6.9 CGCTATATAATTTATTATATAACG
Enterobacter sp. 638 Ent638_3406 -39 6.4 CGCTGTATAATTTATTATATATCG
Serratia proteamaculans 568 Spro_3145 -45 6.8 CGTTATATAATTATTTATATAGCG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA0060 -44 6.6 CGTTATATTATTTAATATATAACG
Edwardsiella tarda EIB202 ETAE_0941 -50 6.3 CGTTATATATTTAGGTATATAGCG
© 2009-2020 RegPrecise