Propagation of ZntR regulog to Salmonella enterica subsp. enterica serovar Typhi Ty2

Reference regulog properties
Source regulog:	ZntR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Zinc resistance
Effector:	Zinc ion, (Zn2+)
Phylum:	Proteobacteria/Gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar Typhi Ty2
Orthologous TF(s)	t4093
Regulated genes	1

Built upon 11 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar Typhi Ty2*
	Locus tag	Position	Score	Sequence
Position: -67 Score: 7.7 Sequence: ACTCTGGAGTCGACTCCAGAGT Locus tag: t3946
	t3946	-67	7.7	ACTCTGGAGTCGACTCCAGAGT
Supported by regulated orthologs from reference regulons
Ortholog gene name: zntA
Ortholog function: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4)
Escherichia coli str. K-12 substr. MG1655	b3469	-64	7.7	ACTCTGGAGTCGACTCCAGAGT
Salmonella typhimurium LT2	STM3576	-67	7.7	ACTCTGGAGTCGACTCCAGAGT
Citrobacter koseri ATCC BAA-895	CKO_04898	-67	7.7	ACTCTGGAGTCGACTCCAGAGT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_03835	-67	7.7	ACTCTGGAGTCGACTCCAGAGT
Enterobacter sp. 638	Ent638_3873	-66	7.7	ACTCTGGAGTCGACTCCAGAGT
Erwinia amylovora ATCC 49946	EAM_3299	-76	6.9	ACTCTGGAGCTAACTCCAGAGT
Yersinia pestis KIM	y0410	-135	7.1	ACTCTGGAGTTGGCTCCAAGGT
Serratia proteamaculans 568	Spro_0209	-69	7.4	ACTCTGGAGTTGACTCCAGGGT
Edwardsiella tarda EIB202	ETAE_0137	-71	7.3	ACTCTGGAGTCGACTCCAACGT
Proteus mirabilis HI4320	PMI3600	-74	6.5	ACTCTGGACTCTACTCCAAGCT
Photorhabdus luminescens subsp. laumondii TTO1	plu4108	-70	7.1	ACTCTGGAGTAGGCTCCAAAGT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --