Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of ModE regulog to Providencia rettgeri DSM 1131

Reference regulog properties
Source regulog: ModE - Enterobacteriales
Regulator type: Transcription factor
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis; Molybdenum homeostasis
Effector: Molybdate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Providencia rettgeri DSM 1131
Orthologous TF(s) PROVRETT_02988
Regulated genes 3
Built upon 55 sites [see more]
Predicted regulatory interactions in Providencia rettgeri DSM 1131
Locus tag Position Score Sequence
Position: -112
Score: 6.3
Sequence: CGTTGTATATAATAATATATATCG
Locus tag: PROVRETT_03009
PROVRETT_03009 -112 6.3 CGTTGTATATAATAATATATATCG
Supported by regulated orthologs from reference regulons
Ortholog gene name: moaA
Ortholog function: Molybdenum cofactor biosynthesis protein MoaA
Escherichia coli str. K-12 substr. MG1655 b0781 -199 6.8 CGCTATATACATGATTACATAGCG
Salmonella typhimurium LT2 STM0802 -200 6.6 CGCTATGTATATGTTTATATAGCG
Citrobacter koseri ATCC BAA-895 CKO_02345 -189 6.9 CGCTATATACATGATTATATAGCG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_00810 -193 6.8 CGATATATATAAGATTATATAGCG
Enterobacter sp. 638 Ent638_1273 -172 6.1 CGCTATGTATAGAATTATACAGCG
Erwinia amylovora ATCC 49946 EAM_1218 -211 6.5 CGCTATATATCAAAATATATAGCG
Yersinia pestis KIM y3023 -242 6.5 CGTTGTATATAATAATATATAGCG
Serratia proteamaculans 568 Spro_1320 -242 6.6 CGCTGTATACACAATTATATAGCG
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2817 -256 6.5 CGCTATATATTATCTTATATATCG
Edwardsiella tarda EIB202 ETAE_2347 -312 6.9 CGTTATATTTTTGATTATATAACG
Proteus mirabilis HI4320 PMI0610 -241 6.6 CGTTGTATTATAAATTATATAACG
Photorhabdus luminescens subsp. laumondii TTO1 plu1499 -234 6.2 AGGTATATATTCAATTATATAACG