Propagation of NagC regulog to Salmonella enterica subsp. enterica serovar Typhi str. E01-6750

Reference regulog properties
Source regulog:	NagC - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	ROK
Regulation mode:	repressor (activator)
Biological process:	N-acetylglucosamine utilization
Effector:	N-acetylglucosamine-6-phosphate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Salmonella enterica subsp. enterica serovar Typhi str. E01-6750
Orthologous TF(s)	Salmonentericaenterica_010100040548, Salmonentericaenterica_010100034192, Salmonentericaenterica_010100037412
Regulated genes	1

Built upon 68 sites [see more]

Predicted regulatory interactions in *Salmonella enterica subsp. enterica serovar Typhi str. E01-6750*
	Locus tag	Position	Score	Sequence
Position: -140 Score: 4.7 Sequence: TATTTTTCAGATAATTAAATAAT Locus tag: Salmonentericaenterica_010100030923
	Salmonentericaenterica_010100030923	-140	4.7	TATTTTTCAGATAATTAAATAAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: galP
Ortholog function: D-galactose transporter
Escherichia coli str. K-12 substr. MG1655	b2943	-39	5.2	CTTAATTCACAATAAAAAATAAC
Salmonella typhimurium LT2	STM3091	-139	4.7	TATTTTTCAGATAATTAAATAAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --