Propagation of NagC regulog to Salmonella enterica subsp. enterica serovar Typhi str. E01-6750
| Source regulog: | NagC - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | ROK |
| Regulation mode: | repressor (activator) |
| Biological process: | N-acetylglucosamine utilization |
| Effector: | N-acetylglucosamine-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Propagated regulon: | |
| Target genome | Salmonella enterica subsp. enterica serovar Typhi str. E01-6750 |
| Orthologous TF(s) | Salmonentericaenterica_010100040548, Salmonentericaenterica_010100034192, Salmonentericaenterica_010100037412 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -140
Score: 4.7 Sequence: TATTTTTCAGATAATTAAATAAT
Locus tag: Salmonentericaenterica_010100030923
|
||||
| Salmonentericaenterica_010100030923 | -140 | 4.7 | TATTTTTCAGATAATTAAATAAT | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: galP | ||||
| Ortholog function: D-galactose transporter | ||||
| Escherichia coli str. K-12 substr. MG1655 | b2943 | -39 | 5.2 | CTTAATTCACAATAAAAAATAAC |
| Salmonella typhimurium LT2 | STM3091 | -139 | 4.7 | TATTTTTCAGATAATTAAATAAT |