Propagation of ZntR regulog to Salmonella enterica subsp. enterica serovar Typhi str. E00-7866
Source regulog: | ZntR - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | MerR |
Regulation mode: | activator |
Biological process: | Zinc resistance |
Effector: | Zinc ion, (Zn2+) |
Phylum: | Proteobacteria/Gamma |
Propagated regulon: | |
Target genome | Salmonella enterica subsp. enterica serovar Typhi str. E00-7866 |
Orthologous TF(s) | Salmoneentericaenterica_010100008153 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -67
Score: 7.7 Sequence: ACTCTGGAGTCGACTCCAGAGT
Locus tag: Salmoneentericaenterica_010100009877
|
||||
Salmoneentericaenterica_010100009877 | -67 | 7.7 | ACTCTGGAGTCGACTCCAGAGT | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: zntA | ||||
Ortholog function: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) (EC 3.6.3.5); Copper-translocating P-type ATPase (EC 3.6.3.4) | ||||
Escherichia coli str. K-12 substr. MG1655 | b3469 | -64 | 7.7 | ACTCTGGAGTCGACTCCAGAGT |
Salmonella typhimurium LT2 | STM3576 | -67 | 7.7 | ACTCTGGAGTCGACTCCAGAGT |
Citrobacter koseri ATCC BAA-895 | CKO_04898 | -67 | 7.7 | ACTCTGGAGTCGACTCCAGAGT |
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_03835 | -67 | 7.7 | ACTCTGGAGTCGACTCCAGAGT |
Enterobacter sp. 638 | Ent638_3873 | -66 | 7.7 | ACTCTGGAGTCGACTCCAGAGT |
Erwinia amylovora ATCC 49946 | EAM_3299 | -76 | 6.9 | ACTCTGGAGCTAACTCCAGAGT |
Yersinia pestis KIM | y0410 | -135 | 7.1 | ACTCTGGAGTTGGCTCCAAGGT |
Serratia proteamaculans 568 | Spro_0209 | -69 | 7.4 | ACTCTGGAGTTGACTCCAGGGT |
Edwardsiella tarda EIB202 | ETAE_0137 | -71 | 7.3 | ACTCTGGAGTCGACTCCAACGT |
Proteus mirabilis HI4320 | PMI3600 | -74 | 6.5 | ACTCTGGACTCTACTCCAAGCT |
Photorhabdus luminescens subsp. laumondii TTO1 | plu4108 | -70 | 7.1 | ACTCTGGAGTAGGCTCCAAAGT |