Propagation of ModE regulog to Pantoea ananatis LMG 20103

Reference regulog properties
Source regulog:	ModE - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdopterin biosynthesis; Molybdenum homeostasis
Effector:	Molybdate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Pantoea ananatis LMG 20103
Orthologous TF(s)	PANA_1205
Regulated genes	2

Built upon 55 sites [see more]

Predicted regulatory interactions in *Pantoea ananatis LMG 20103*
	Locus tag	Position	Score	Sequence
Position: 22 Score: 6.2 Sequence: CGTTGTATTATTCAATATATAACG Locus tag: PANA_1207
	PANA_1207	22	6.2	CGTTGTATTATTCAATATATAACG
Supported by regulated orthologs from reference regulons
Ortholog gene name: modA
Ortholog function: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Escherichia coli str. K-12 substr. MG1655	b0763	-43	6.2	CGTTATATTGTCGCCTACATAACG
Salmonella typhimurium LT2	STM0781	-44	6.6	CGTTATATTATCGTTTACATAACG
Citrobacter koseri ATCC BAA-895	CKO_02372	-43	6.3	CGCTATATTTGCGCCTACATAACG
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_00777	-42	6.6	CGTTATATTATCGACTACATAACG
Enterobacter sp. 638	Ent638_1254	-43	6.6	CGTTATATTTATTTGTATATAACG
Erwinia amylovora ATCC 49946	EAM_1202	-44	6	CGTTATATCATCATATATATAGCG
Yersinia pestis KIM	y3037	-35	6	CGCTATATTCCTCCGTATATAACG
Serratia proteamaculans 568	Spro_1303	-60	6.7	CGTTATATTATTTTTTATATAACG
Erwinia carotovora subsp. atroseptica SCRI1043	ECA1393	-44	6.4	CGTTATATTATTATTTACACAACG
Edwardsiella tarda EIB202	ETAE_2559	-48	6.3	CGCCATATAATCGATTATACAACG
Proteus mirabilis HI4320	PMI0597	-108	6	CGCTATATTTATTGATATATAACC
		-55	5.6	CGTTATATCTTGATATATACAGCG

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --