Propagation of UlaR regulog to Escherichia coli O157:H7 str. EC869
| Source regulog: | UlaR - Enterobacteriales |
| Regulator type: | Transcription factor |
| Regulator family: | DeoR |
| Regulation mode: | repressor |
| Biological process: | Ascorbate utilization |
| Effector: | Ascorbate-6-phosphate |
| Phylum: | Proteobacteria |
| Propagated regulon: | |
| Target genome | Escherichia coli O157:H7 str. EC869 |
| Orthologous TF(s) | EcolO1_010100001180 |
| Regulated genes | 1 |
| Locus tag | Position | Score | Sequence | |
|---|---|---|---|---|
|
Position: -82
Score: 5.3 Sequence: TGATTACTTTTGAAAATTAG
Locus tag: EcolO1_010100001190
|
||||
| EcolO1_010100001190 | -82 | 5.3 | TGATTACTTTTGAAAATTAG | |
| Supported by regulated orthologs from reference regulons | ||||
| Ortholog gene name: ulaA | ||||
| Ortholog function: Ascorbate-specific PTS system, EIIC component | ||||
| Citrobacter koseri ATCC BAA-895 | CKO_03643 | -82 | 5.3 | TGATTACTTTTGAAAATTAG |
| Escherichia coli str. K-12 substr. MG1655 | b4193 | -82 | 5.3 | TGATTACTTTTGAAAATTAG |
| Salmonella typhimurium LT2 | STM4383.S | -80 | 5.4 | TGATTACTTTTGAAAATTAA |