Propagation of Zur regulog to Geobacillus thermodenitrificans NG80-2

Reference regulog properties
Source regulog:	Zur - Bacillales
Regulator type:	Transcription factor
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Phylum:	Firmicutes
Propagated regulon:
Target genome	Geobacillus thermodenitrificans NG80-2
Orthologous TF(s)	GTNG_2406
Regulated genes	1

Built upon 67 sites [see more]

Predicted regulatory interactions in *Geobacillus thermodenitrificans NG80-2*
	Locus tag	Position	Score	Sequence
Position: -39 Score: 6 Sequence: TAAATCGTAACGATTCTGAATTA Locus tag: GTNG_2408
	GTNG_2408	-39	6	TAAATCGTAACGATTCTGAATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: znuC
Ortholog function: Zinc ABC transporter, ATP-binding protein ZnuC
Bacillus pumilus SAFR-032	BPUM_2243	-46	5.4	TAAATCGTAATCATTCTTTTTAT
Anoxybacillus flavithermus WK1	Aflv_0867	-36	5.7	TGAATCGGAATCATTTTGAATTA
Geobacillus kaustophilus HTA426	GK2471	-39	5.8	CAAATCGGAATGATTCTGAATTA
Bacillus cereus ATCC 14579	BC4279	-39	6	TAAATCGGAATCATTCTGAATTA
Bacillus halodurans C-125	BH1394	-72	5	TAAATCGGAATGATTCTTAATAT
Bacillus clausii KSM-K16	ABC1702	-39	5.1	TAAATCGGAAGCATTCTGAATAA
Oceanobacillus iheyensis HTE831	OB2396	-297	6	TAATTCGTAACGATTCCTATTTA
		-274	5.1	CATTTCATAATCATTACGCTATT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --