Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of Zur regulog to Geobacillus thermodenitrificans NG80-2

Reference regulog properties
Source regulog: Zur - Bacillales
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Firmicutes
Propagated regulon:
Target genome Geobacillus thermodenitrificans NG80-2
Orthologous TF(s) GTNG_2406
Regulated genes 1
Built upon 67 sites [see more]
Predicted regulatory interactions in Geobacillus thermodenitrificans NG80-2
Locus tag Position Score Sequence
Position: -39
Score: 6
Sequence: TAAATCGTAACGATTCTGAATTA
Locus tag: GTNG_2408
GTNG_2408 -39 6 TAAATCGTAACGATTCTGAATTA
Supported by regulated orthologs from reference regulons
Ortholog gene name: znuC
Ortholog function: Zinc ABC transporter, ATP-binding protein ZnuC
Bacillus pumilus SAFR-032 BPUM_2243 -46 5.4 TAAATCGTAATCATTCTTTTTAT
Anoxybacillus flavithermus WK1 Aflv_0867 -36 5.7 TGAATCGGAATCATTTTGAATTA
Geobacillus kaustophilus HTA426 GK2471 -39 5.8 CAAATCGGAATGATTCTGAATTA
Bacillus cereus ATCC 14579 BC4279 -39 6 TAAATCGGAATCATTCTGAATTA
Bacillus halodurans C-125 BH1394 -72 5 TAAATCGGAATGATTCTTAATAT
Bacillus clausii KSM-K16 ABC1702 -39 5.1 TAAATCGGAAGCATTCTGAATAA
Oceanobacillus iheyensis HTE831 OB2396 -297 6 TAATTCGTAACGATTCCTATTTA
-274 5.1 CATTTCATAATCATTACGCTATT