Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of SorC regulog to Yersinia mollaretii ATCC 43969

Reference regulog properties
Source regulog: SorC - Enterobacteriales
Regulator type: Transcription factor
Regulator family: SorC
Regulation mode: activator (repressor)
Biological process: Sorbose utilization
Effector: Sorbose
Phylum: Proteobacteria
Propagated regulon:
Target genome Yersinia mollaretii ATCC 43969
Orthologous TF(s) YmolA_01002398
Regulated genes 1
Built upon 1 sites [see more]
Predicted regulatory interactions in Yersinia mollaretii ATCC 43969
Locus tag Position Score Sequence
Position: -12
Score: 6.5
Sequence: ATCTGCACAAATGTGCAAGA
Locus tag: YmolA_01002398
YmolA_01002398 -12 6.5 ATCTGCACAAATGTGCAAGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: sorC
Ortholog function: Sorbitol utilization transcriptional regulator, SorC family
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04408 -28 6.5 ATTTGCACAAATGTGCAGGA
© 2009-2020 RegPrecise