Propagation of SorC regulog to Yersinia frederiksenii ATCC 33641

Reference regulog properties
Source regulog:	SorC - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	SorC
Regulation mode:	activator (repressor)
Biological process:	Sorbose utilization
Effector:	Sorbose
Phylum:	Proteobacteria
Propagated regulon:
Target genome	Yersinia frederiksenii ATCC 33641
Orthologous TF(s)	YfreA_01000046
Regulated genes	1

Built upon 1 sites [see more]

Predicted regulatory interactions in *Yersinia frederiksenii ATCC 33641*
	Locus tag	Position	Score	Sequence
Position: -293 Score: 6.8 Sequence: TTCTGCACATATGTGCAAAA Locus tag: YfreA_01000046
	YfreA_01000046	-293	6.8	TTCTGCACATATGTGCAAAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: sorC
Ortholog function: Sorbitol utilization transcriptional regulator, SorC family
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_04408	-28	6.5	ATTTGCACAAATGTGCAGGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --