Propagation of AscG regulog to Yersinia frederiksenii ATCC 33641

Reference regulog properties
Source regulog:	AscG - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization; Cellobiose utilization
Effector:	Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Yersinia frederiksenii ATCC 33641
Orthologous TF(s)	YfreA_01000726
Regulated genes	2

Built upon 28 sites [see more]

Predicted regulatory interactions in *Yersinia frederiksenii ATCC 33641*
	Locus tag	Position	Score	Sequence
Position: -95 Score: 4.6 Sequence: AACGGAAAACGGTTTCCTCA Locus tag: YfreA_01000685
	YfreA_01000685	-95	4.6	AACGGAAAACGGTTTCCTCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: celA
Ortholog function: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_04054	-198	4.3	TTTGGAAACCGATTTTCCAT
		-72	4.6	AATGGAAACCGGTTTCCGTC
Enterobacter sp. 638	Ent638_0038	-72	4.7	AATGGAAACCGGTTTCCATA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --