Propagation of AscG regulog to Pectobacterium wasabiae WPP163

Reference regulog properties
Source regulog:	AscG - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization; Cellobiose utilization
Effector:	Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Pectobacterium wasabiae WPP163
Orthologous TF(s)	Pecwa_2483, Pecwa_0007
Regulated genes	4

Built upon 28 sites [see more]

Predicted regulatory interactions in *Pectobacterium wasabiae WPP163*
	Locus tag	Position	Score	Sequence
Position: -164 Score: 6.4 Sequence: ATATGCAACCGGTTTCATAT Locus tag: Pecwa_0007
	Pecwa_0007	-164	6.4	ATATGCAACCGGTTTCATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ascG
Ortholog function: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
Erwinia amylovora ATCC 49946	EAM_2929	-297	6.1	TTCTGCAACCGGTTTCATAT
Erwinia carotovora subsp. atroseptica SCRI1043	ECA4436	-164	6.4	ATATGCAACCGGTTTCATAT

Position: -69 Score: 6.6 Sequence: ATATGAAACCGGTTGCATAT Locus tag: Pecwa_0008
	Pecwa_0008	-69	6.6	ATATGAAACCGGTTGCATAT
Supported by regulated orthologs from reference regulons
Ortholog gene name: bglE
Ortholog function: PTS system, beta-glucoside-specific IIB component (EC 2.7.1.69)
Erwinia amylovora ATCC 49946	EAM_2930	-68	6.6	ATATGAAACCGGTTGCAGAA
Erwinia carotovora subsp. atroseptica SCRI1043	ECA4435	-69	6.6	ATATGAAACCGGTTGCATAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --