Propagation of EbgR regulog to Escherichia coli O157:H7 str. Sakai

Reference regulog properties
Source regulog:	EbgR - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactosides utilization
Effector:	Beta-galactosides
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Escherichia coli O157:H7 str. Sakai
Orthologous TF(s)	ECs3957
Regulated genes	2

Built upon 5 sites [see more]

Predicted regulatory interactions in *Escherichia coli O157:H7 str. Sakai*
	Locus tag	Position	Score	Sequence
Position: -201 Score: 5.7 Sequence: TAAAATTTTACTAAACTATAG Locus tag: ECs3957
	ECs3957	-201	5.7	TAAAATTTTACTAAACTATAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: ebgR
Ortholog function: Evolved beta-D-galactosidase transcriptional repressor, LacI family
Escherichia coli str. K-12 substr. MG1655	b3075	-201	5.7	TAAAATTTTACTAAACTATAG
Serratia proteamaculans 568	Spro_1972	-223	5.9	AAAATATTTAGTAAAAAATAC

Position: -94 Score: 6.2 Sequence: CTACTTTTTAGTAAAAATTTT Locus tag: ECs3958
	ECs3958	-94	6.2	CTACTTTTTAGTAAAAATTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ebgA
Ortholog function: Evolved beta-D-galactosidase, alpha subunit
Escherichia coli str. K-12 substr. MG1655	b3076	-94	6.2	CTACTTTTTAGTAAAAATTTT
Serratia proteamaculans 568	Spro_1973	-59	6.2	GTGAATTTTACTAAATATTTA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --