Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of AscG regulog to Escherichia coli O157:H7 str. EC4024

Reference regulog properties
Source regulog: AscG - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization; Cellobiose utilization
Effector: Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli O157:H7 str. EC4024
Orthologous TF(s) EscherichcoliO157_010100018875
Regulated genes 2
Built upon 28 sites [see more]
Predicted regulatory interactions in Escherichia coli O157:H7 str. EC4024
Locus tag Position Score Sequence
Position: -175
Score: 6.3
Sequence: TTAAGAAACCGGTTTCACAA
Locus tag: EscherichcoliO157_010100018875
EscherichcoliO157_010100018875 -175 6.3 TTAAGAAACCGGTTTCACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ascG
Ortholog function: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
Escherichia coli str. K-12 substr. MG1655 b2714 -175 6.3 TTAAGAAACCGGTTTCACAA
Citrobacter koseri ATCC BAA-895 CKO_04069 -172 6.7 ATAGGAAACCGGTTCCACAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03050 -194 6.7 ATAGGAAACCGGTTCCACAA
Enterobacter sp. 638 Ent638_3187 -182 6.7 ATAGGAAACCGGTTTCACAA
Serratia proteamaculans 568 Spro_0577 -193 6.5 ATAAGAAACCGGTTTCACAA
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2164 -173 6 ATGGGTAACCGGTTCCACAT
Position: -177
Score: 5.1
Sequence: TCAGGTGACCGGTTTCACAA
Position: -101
Score: 5.8
Sequence: TTGTGAAACCGGTTTCTTAA
Locus tag: EscherichcoliO157_010100018880
EscherichcoliO157_010100018880 -177 5.1 TCAGGTGACCGGTTTCACAA
-101 5.8 TTGTGAAACCGGTTTCTTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ascF
Ortholog function: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
Escherichia coli str. K-12 substr. MG1655 b2715 -177 5.1 TCAGGTGACCGGTTTCACAA
-101 5.8 TTGTGAAACCGGTTTCTTAA
Citrobacter koseri ATCC BAA-895 CKO_04070 -103 5.1 TTGTGGAACCGGTTTCCTAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_03051 -93 5.1 TTGTGGAACCGGTTTCCTAT
Enterobacter sp. 638 Ent638_3188 -52 5.6 TTGTGAAACCGGTTTCCTAT
Serratia proteamaculans 568 Spro_0576 -113 5.8 TTGTGAAACCGGTTTCTTAT
Erwinia carotovora subsp. atroseptica SCRI1043 ECA2165 -180 5.1 ATGTGGAACCGGTTACCCAT