Propagation of SorC regulog to Escherichia coli O157:H7 str. EC4113
Source regulog: | SorC - Enterobacteriales |
Regulator type: | Transcription factor |
Regulator family: | SorC |
Regulation mode: | activator (repressor) |
Biological process: | Sorbose utilization |
Effector: | Sorbose |
Phylum: | Proteobacteria |
Propagated regulon: | |
Target genome | Escherichia coli O157:H7 str. EC4113 |
Orthologous TF(s) | EsccoliO157_010100020870 |
Regulated genes | 1 |

Locus tag | Position | Score | Sequence | |
---|---|---|---|---|
Position: -33
Score: 6.5 Sequence: ATTTGCACAAATGTGCAGAA
Locus tag: EsccoliO157_010100020870
|
||||
EsccoliO157_010100020870 | -33 | 6.5 | ATTTGCACAAATGTGCAGAA | |
Supported by regulated orthologs from reference regulons | ||||
Ortholog gene name: sorC | ||||
Ortholog function: Sorbitol utilization transcriptional regulator, SorC family | ||||
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | KPN_04408 | -28 | 6.5 | ATTTGCACAAATGTGCAGGA |