Propagation of SorC regulog to Yersinia enterocolitica subsp. enterocolitica 8081

Reference regulog properties
Source regulog:	SorC - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	SorC
Regulation mode:	activator (repressor)
Biological process:	Sorbose utilization
Effector:	Sorbose
Phylum:	Proteobacteria
Propagated regulon:
Target genome	Yersinia enterocolitica subsp. enterocolitica 8081
Orthologous TF(s)	YE0815
Regulated genes	1

Built upon 1 sites [see more]

Predicted regulatory interactions in *Yersinia enterocolitica subsp. enterocolitica 8081*
	Locus tag	Position	Score	Sequence
Position: -27 Score: 6.5 Sequence: ATTTGCACAAATGTGCAAGA Locus tag: YE0815
	YE0815	-27	6.5	ATTTGCACAAATGTGCAAGA
Supported by regulated orthologs from reference regulons
Ortholog gene name: sorC
Ortholog function: Sorbitol utilization transcriptional regulator, SorC family
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_04408	-28	6.5	ATTTGCACAAATGTGCAGGA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --