Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of UlaR regulog to Escherichia coli 53638

Reference regulog properties
Source regulog: UlaR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: DeoR
Regulation mode: repressor
Biological process: Ascorbate utilization
Effector: Ascorbate-6-phosphate
Phylum: Proteobacteria
Propagated regulon:
Target genome Escherichia coli 53638
Orthologous TF(s) Ecol5_01000531
Regulated genes 2
Built upon 13 sites [see more]
Predicted regulatory interactions in Escherichia coli 53638
Locus tag Position Score Sequence
Position: -286
Score: 5.3
Sequence: CTAATTTTCAAAAGTAATCA
Locus tag: Ecol5_01000532
Ecol5_01000532 -286 5.3 CTAATTTTCAAAAGTAATCA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ulaG
Ortholog function: Probable L-ascorbate-6-phosphate lactonase UlaG (EC 3.1.1.-) (L-ascorbate utilization protein G)
Citrobacter koseri ATCC BAA-895 CKO_03645 -286 5.3 CTAATTTTCAAAAGTAATCA
-44 4.3 GGATTAATCAAAACAAATCA
Edwardsiella tarda EIB202 ETAE_3290 -75 4.2 CTAGCAATCGTTAAAAATCA
Escherichia coli str. K-12 substr. MG1655 b4192 -292 5.3 CTAATTTTCAAAAGTAATCA
-60 3.9 GGATTAATCAAAACCAATCA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 KPN_04585 -299 5.3 CTAATAATCAAAAATAATCA
-32 4.5 TGATTACTATTGAAAATACG
Salmonella typhimurium LT2 STM4382 -59 4.3 GGATTAATCAAAACAAATCA
Position: -82
Score: 5.3
Sequence: TGATTACTTTTGAAAATTAG
Locus tag: Ecol5_01000533
Ecol5_01000533 -82 5.3 TGATTACTTTTGAAAATTAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: ulaA
Ortholog function: Ascorbate-specific PTS system, EIIC component
Citrobacter koseri ATCC BAA-895 CKO_03643 -82 5.3 TGATTACTTTTGAAAATTAG
Escherichia coli str. K-12 substr. MG1655 b4193 -82 5.3 TGATTACTTTTGAAAATTAG
Salmonella typhimurium LT2 STM4383.S -80 5.4 TGATTACTTTTGAAAATTAA