Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Propagation of EbgR regulog to Escherichia coli 53638

Reference regulog properties
Source regulog: EbgR - Enterobacteriales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Phylum: Proteobacteria/gamma
Propagated regulon:
Target genome Escherichia coli 53638
Orthologous TF(s) Ecol5_01002535
Regulated genes 2
Built upon 5 sites [see more]
Predicted regulatory interactions in Escherichia coli 53638
Locus tag Position Score Sequence
Position: -201
Score: 5.7
Sequence: TAAAATTTTACTAAACTATAG
Locus tag: Ecol5_01002535
Ecol5_01002535 -201 5.7 TAAAATTTTACTAAACTATAG
Supported by regulated orthologs from reference regulons
Ortholog gene name: ebgR
Ortholog function: Evolved beta-D-galactosidase transcriptional repressor, LacI family
Escherichia coli str. K-12 substr. MG1655 b3075 -201 5.7 TAAAATTTTACTAAACTATAG
Serratia proteamaculans 568 Spro_1972 -223 5.9 AAAATATTTAGTAAAAAATAC
Position: -94
Score: 6.2
Sequence: CTACTTTTTAGTAAAAATTTT
Locus tag: Ecol5_01002536
Ecol5_01002536 -94 6.2 CTACTTTTTAGTAAAAATTTT
Supported by regulated orthologs from reference regulons
Ortholog gene name: ebgA
Ortholog function: Evolved beta-D-galactosidase, alpha subunit
Escherichia coli str. K-12 substr. MG1655 b3076 -94 6.2 CTACTTTTTAGTAAAAATTTT
Serratia proteamaculans 568 Spro_1973 -59 6.2 GTGAATTTTACTAAATATTTA
© 2009-2020 RegPrecise