Propagation of AscG regulog to Escherichia coli O157:H7 str. EC4045

Reference regulog properties
Source regulog:	AscG - Enterobacteriales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Beta-glucosides utilization; Cellobiose utilization
Effector:	Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Phylum:	Proteobacteria/gamma
Propagated regulon:
Target genome	Escherichia coli O157:H7 str. EC4045
Orthologous TF(s)	EschericoliO157_010100011209
Regulated genes	2

Built upon 28 sites [see more]

Predicted regulatory interactions in *Escherichia coli O157:H7 str. EC4045*
	Locus tag	Position	Score	Sequence
Position: -175 Score: 6.3 Sequence: TTAAGAAACCGGTTTCACAA Locus tag: EschericoliO157_010100011209
	EschericoliO157_010100011209	-175	6.3	TTAAGAAACCGGTTTCACAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ascG
Ortholog function: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
Escherichia coli str. K-12 substr. MG1655	b2714	-175	6.3	TTAAGAAACCGGTTTCACAA
Citrobacter koseri ATCC BAA-895	CKO_04069	-172	6.7	ATAGGAAACCGGTTCCACAA
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_03050	-194	6.7	ATAGGAAACCGGTTCCACAA
Enterobacter sp. 638	Ent638_3187	-182	6.7	ATAGGAAACCGGTTTCACAA
Serratia proteamaculans 568	Spro_0577	-193	6.5	ATAAGAAACCGGTTTCACAA
Erwinia carotovora subsp. atroseptica SCRI1043	ECA2164	-173	6	ATGGGTAACCGGTTCCACAT

Position: -177 Score: 5.1 Sequence: TCAGGTGACCGGTTTCACAA Position: -101 Score: 5.8 Sequence: TTGTGAAACCGGTTTCTTAA Locus tag: EschericoliO157_010100011214
	EschericoliO157_010100011214	-177	5.1	TCAGGTGACCGGTTTCACAA
		-101	5.8	TTGTGAAACCGGTTTCTTAA
Supported by regulated orthologs from reference regulons
Ortholog gene name: ascF
Ortholog function: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
Escherichia coli str. K-12 substr. MG1655	b2715	-177	5.1	TCAGGTGACCGGTTTCACAA
		-101	5.8	TTGTGAAACCGGTTTCTTAA
Citrobacter koseri ATCC BAA-895	CKO_04070	-103	5.1	TTGTGGAACCGGTTTCCTAT
Klebsiella pneumoniae subsp. pneumoniae MGH 78578	KPN_03051	-93	5.1	TTGTGGAACCGGTTTCCTAT
Enterobacter sp. 638	Ent638_3188	-52	5.6	TTGTGAAACCGGTTTCCTAT
Serratia proteamaculans 568	Spro_0576	-113	5.8	TTGTGAAACCGGTTTCTTAT
Erwinia carotovora subsp. atroseptica SCRI1043	ECA2165	-180	5.1	ATGTGGAACCGGTTACCCAT

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Propagation of AscG regulog to Escherichia coli O157:H7 str. EC4045

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --